Top » Catalog » J1 » FGC29863

$18.00

FGC29863
[FGC29863]

FGC29863
hg38 Position: ChrY:15618867..15618867
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1a (not listed)
Comments: Below FGC1695 > BY8 > BY9 > BY136 > ZS2028
Forward Primer: FGC29863v2_F AAAGAGTAGGGGCCAATATTCAG
Reverse Primer: FGC29863v2_R ACAGAACACCAATTCATCTCGAC
Reviews

Customers who bought this product also purchased
BY136
BY136
FGC31325
FGC31325
J1-M267 Superclade Panel
J1-M267 Superclade Panel
BY8
BY8
ZS2026
ZS2026
FGC1695
FGC1695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC42829
$18.00
Haplogroup Info
Other products
Currencies