Top » Catalog » J1 » A13632

$18.00

A13632
[A13632]

A13632
hg38 Position: ChrY:13259761..13259761
Ancestral: T
Derived: C
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13632_F CCTTTTCCCATCCAATGTTC
Reverse Primer: A13632_R GGCAGATCAGGATGAAGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC38648
1 x A20304
1 x FGC4720
1 x A13635
1 x FGC13864
1 x FGC4358
1 x FGC14446
1 x FGC4356
1 x A15552
1 x ALK193
$180.00
Haplogroup Info
Other products
Currencies