Top » Catalog » J1 » A13635

$18.00

A13635
[A13635]

A13635
hg38 Position: ChrY:15698276..15698276
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13635_F GATGCAGCCAATTAGAGAGTTG
Reverse Primer: A13635_R GGAAATGTTGGCCCATAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies