Top » Catalog » J1 » A13638

$18.00

A13638
[A13638]

A13638
hg38 Position: ChrY:8992399..8992399
Ancestral: G
Derived: A
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13638_F AAAATGGTGGCACAGTGATG
Reverse Primer: A13638_R CCTTTCTGGAGCAAATGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC40447
1 x FGC12857
1 x FGC37843
1 x BY32851
1 x ALK161
1 x ALK281
1 x FGC4417
1 x FGC4402
1 x A18931
1 x FGC4339
1 x A16982
1 x FGC40060
1 x ALK485
1 x A13639
1 x FGC8714
1 x FGC45522
1 x FGC16722
1 x A14638
$324.00
Haplogroup Info
Other products
Currencies