Top » Catalog » J1 » A13639

$18.00

A13639
[A13639]

A13639
hg38 Position: ChrY:11686085..11686085
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13639_F CTGGAACAAAACGGAAATTAAC
Reverse Primer: A13639_R TTCCATTCATGTCAATCACG
Reviews

Customers who bought this product also purchased
A13641
A13641
Y19869
Y19869
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies