Top » Catalog » J1 » A13640

$18.00

A13640
[A13640]

A13640
hg38 Position: ChrY:13412343..13412343
Ancestral: G
Derived: A
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1a
Comments: Below ZS5809 > A13642
Forward Primer: A13640_F GGCAAAAGTCTGCTTGAATC
Reverse Primer: A13640_R TGCATCATGTGATTAGTGTGC
Reviews

Customers who bought this product also purchased
A13646
A13646
A13645
A13645
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies