Top » Catalog » J1 » A13640

$18.00

A13640
[A13640]

A13640
hg38 Position: ChrY:13412343..13412343
Ancestral: G
Derived: A
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1a
Comments: Below ZS5809 > A13642
Forward Primer: A13640_F GGCAAAAGTCTGCTTGAATC
Reverse Primer: A13640_R TGCATCATGTGATTAGTGTGC
Reviews

Customers who bought this product also purchased
A13646
A13646
A13645
A13645
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies