Top » Catalog » J1 » A13641

$18.00

A13641
[A13641]

A13641
hg38 Position: ChrY:14995895..14995895
Ancestral: A
Derived: G
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13641_F TGTCCATACAAGCAATCACTCC
Reverse Primer: A13641_R CCCCACTGAGCCACATAAG
Reviews

Customers who bought this product also purchased
Y19869
Y19869
A13639
A13639
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK8
1 x BY70856
1 x FGC50950
1 x FGC48131
1 x A14648
1 x ALK7
1 x FGC4244
1 x FGC43122
1 x A22250
1 x FGC7392
1 x FGC8715
1 x BY171997
1 x A22240
1 x A23665
1 x A18552
1 x FGC47230
1 x FGC7381
1 x FGC6778
1 x FGC5234
$342.00
Haplogroup Info
Other products
Currencies