Top » Catalog » J1 » A13648

$18.00

A13648
[A13648]

A13648
hg38 Position: ChrY:12432684..12432684
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13648_F ACTGGTGGGCATTTAGTTTG
Reverse Primer: A13648_R AGGATTGGCTCAAAAGCAAC
Reviews

Customers who bought this product also purchased
A13649
A13649
A13647
A13647
M4610
M4610
A13651
A13651
A13650
A13650
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies