Top » Catalog » J1 » A13651

$18.00

A13651
[A13651]

A13651
hg38 Position: ChrY:7686710..7686710
Ancestral: G
Derived: A
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13651_F AGTGCCCATTAACCCCTTTC
Reverse Primer: A13651_R TCAGCATGGTCTTATGCACAG
Reviews

Customers who bought this product also purchased
A13648
A13648
A13647
A13647
M4610
M4610
A13650
A13650
A13649
A13649
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies