Top » Catalog » J1 » A13634

$18.00

A13634
[A13634]

A13634
hg38 Position: ChrY:15275392..15275392
Ancestral: A
Derived: G
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13634_F TTGTTCTGGATGAGTTGGTG
Reverse Primer: A13634_R AGGTGGTGGATCATCTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies