Top » Catalog » J1 » A13634

$18.00

A13634
[A13634]

A13634
hg38 Position: ChrY:15275392..15275392
Ancestral: A
Derived: G
Reference: Ahmad Alroqi (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A13634_F TTGTTCTGGATGAGTTGGTG
Reverse Primer: A13634_R AGGTGGTGGATCATCTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK477
1 x FGC48147
1 x BY63983
1 x FGC34537
1 x A15549
1 x CTS4352
1 x FGC42836
1 x FGC37534
1 x ALK1
1 x FGC4742
1 x FGC4279
1 x ALK272
1 x FGC35893
1 x FGC37540
1 x FGC48151
1 x BY8
1 x A13646
1 x A11234
1 x A20820
1 x A19266
1 x BY50885
$378.00
Haplogroup Info
Other products
Currencies