Top » Catalog » J1 » FGC17487

$18.00

FGC17487
[FGC17487]

FGC17487
hg38 Position: ChrY:15925995..15925995
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1c (not listed)
Comments: Below ZS227 > FGC13864
Forward Primer: FGC17487_F TCTTAAAAATGCCACTTCTGTGAC
Reverse Primer: FGC17487_R GATTCCATGCATTTGCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47787
1 x FGC4296
1 x FGC4751
1 x FGC48153
1 x FGC4280
1 x ALK459
1 x A22234
1 x A23463
1 x BY53798
1 x A12922
1 x FGC14439
1 x FGC4761
1 x ALK464
1 x FGC22247
1 x FGC7393
1 x FGC4297
1 x A15547
1 x FGC4711
1 x FGC4239
1 x ALK898
$360.00
Haplogroup Info
Other products
Currencies