Top » Catalog » J1 » FGC17487

$18.00

FGC17487
[FGC17487]

FGC17487
hg38 Position: ChrY:15925995..15925995
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1c (not listed)
Comments: Below ZS227 > FGC13864
Forward Primer: FGC17487_F TCTTAAAAATGCCACTTCTGTGAC
Reverse Primer: FGC17487_R GATTCCATGCATTTGCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies