Top » Catalog » J1 » FGC15940

$18.00

FGC15940
[FGC15940]

FGC15940
hg38 Position: ChrY:6805868..6805868
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC15940_F TGGTAATTGCTACTTGAAGCAGG
Reverse Primer: FGC15940_R AATTCAGTGGGTCCCATGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies