Top » Catalog » J1 » FGC8223

$18.00

FGC8223
[FGC8223]

FGC8223
hg38 Position: ChrY:18968946..18968946
Ancestral: C
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Downstream FGC8224
Forward Primer: FGC8223_F GTGGGAGGATTGCTTGAGTC
Reverse Primer: FGC8223_R TGGTCTCAGCATCCAACTTTAC
Reviews

Customers who bought this product also purchased
Z1889
Z1889
ZS12248
ZS12248
FGC4415
FGC4415
FGC8224
FGC8224
FGC15940
FGC15940
Z1865
Z1865
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies