Top » Catalog » J1 » FGC8223

$18.00

FGC8223
[FGC8223]

FGC8223
hg38 Position: ChrY:18968946..18968946
Ancestral: C
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Downstream FGC8224
Forward Primer: FGC8223_F GTGGGAGGATTGCTTGAGTC
Reverse Primer: FGC8223_R TGGTCTCAGCATCCAACTTTAC
Reviews

Customers who bought this product also purchased
PF4869
PF4869
ZS4346
ZS4346
ZS4370
ZS4370
ZS9046
ZS9046
ZS7540
ZS7540
FGC58459
FGC58459
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies