Top » Catalog » J1 » FGC8224

$18.00

FGC8224
[FGC8224]

FGC8224
hg38 Position: ChrY:19093140..19093140
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC8224_F GTCCAGTTTCTCTTGGAGGC
Reverse Primer: FGC8224_R CATAGGGGAAGGCAAGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BZ1664
$18.00
Haplogroup Info
Other products
Currencies