Top » Catalog » J1 » FGC8224

$18.00

FGC8224
[FGC8224]

FGC8224
hg38 Position: ChrY:19093140..19093140
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC8224_F GTCCAGTTTCTCTTGGAGGC
Reverse Primer: FGC8224_R CATAGGGGAAGGCAAGGAG
Reviews

Customers who bought this product also purchased
ZS12248
ZS12248
FGC4415
FGC4415
Z640
Z640
FGC8223
FGC8223
FGC11
FGC11
Z1865
Z1865
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies