Top » Catalog » J1 » FGC4342

$18.00

FGC4342
[FGC4342]

FGC4342
hg38 Position: ChrY:8939137..8939137
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC9 > FGC4340
Forward Primer: FGC4342_F GCACCAATCTGCACTCTGG
Reverse Primer: FGC4342_R GCGTTTACAATCCCTGAGCTATAC
Reviews

Customers who bought this product also purchased
FGC4353
FGC4353
FGC4355
FGC4355
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC4340
FGC4340
L858
L858
FGC39175
FGC39175
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies