Top » Catalog » J1 » FGC4350

$18.00

FGC4350
[FGC4350]

FGC4350
hg38 Position: ChrY:16075560..16075560
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC9 > FGC4340
Forward Primer: FGC4350v2_F TTGCCTTTGAGGATCCCAG
Reverse Primer: FGC4350v2_R ATGAGTATTTGCCCTCTGGC
Reviews

Customers who bought this product also purchased
FGC7942
FGC7942
FGC19506
FGC19506
FGC4342
FGC4342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies