Top » Catalog » J1 » A14643

$18.00

A14643
[A14643]

A14643
hg38 Position: ChrY:13837945..13837945
Ancestral: C
Derived: A
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A14643_F AACTGGGAATTTCTACTGTAATTGG
Reverse Primer: A14643_R AGCCAGACTCCATTTTTGAAG
Reviews

Customers who bought this product also purchased
FGC7
FGC7
ZS5809
ZS5809
ZS11521
ZS11521
FGC1713
FGC1713
FGC1715
FGC1715
FGC42835
FGC42835
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies