Top » Catalog » J1 » A14643

$18.00

A14643
[A14643]

A14643
hg38 Position: ChrY:13837945..13837945
Ancestral: C
Derived: A
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A14643_F AACTGGGAATTTCTACTGTAATTGG
Reverse Primer: A14643_R AGCCAGACTCCATTTTTGAAG
Reviews

Customers who bought this product also purchased
L858
L858
A12921
A12921
FGC4371
FGC4371
ZS5806
ZS5806
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS5814
ZS5814
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC38645
1 x FGC4295
1 x FGC11723
1 x FGC16666
1 x FGC5225
1 x ALK358
1 x FGC5241
1 x CTS5551
1 x FGC29872
1 x BY13781
$180.00
Haplogroup Info
Other products
Currencies