Top » Catalog » J1 » A14643

$18.00

A14643
[A14643]

A14643
hg38 Position: ChrY:13837945..13837945
Ancestral: C
Derived: A
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A14643_F AACTGGGAATTTCTACTGTAATTGG
Reverse Primer: A14643_R AGCCAGACTCCATTTTTGAAG
Reviews

Customers who bought this product also purchased
ZS8569
ZS8569
FGC1707
FGC1707
FGC4453
FGC4453
ZS5805
ZS5805
A12921
A12921
L858
L858
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK576
$18.00
Haplogroup Info
Other products
Currencies