Top » Catalog » J1 » A14645

$18.00

A14645
[A14645]

A14645
hg38 Position: ChrY:18655281..18655281
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A14645_F TGGACCATCCGTCTTTAGTG
Reverse Primer: A14645_R TCAGGAAACTGGCCTATCAAC
Reviews

Customers who bought this product also purchased
A14647
A14647
A14644
A14644
A14643
A14643
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies