Top » Catalog » J1 » A14647

$18.00

A14647
[A14647]

A14647
hg38 Position: ChrY:3294734..3294734
Ancestral: A
Derived: G
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A14647_F GTGTCCCAGAAGGGCAAG
Reverse Primer: A14647_R TGAAGGTGTCATGGGAACTG
Reviews

Customers who bought this product also purchased
A14643
A14643
A14645
A14645
A14644
A14644
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies