Top » Catalog » J1 » A14648

$18.00

A14648
[A14648]

A14648
hg38 Position: ChrY:11699833..11699833
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A14648_F GAATGGAATGGTTACAAATAAAATGC
Reverse Primer: A14648_R CATTCAAGTCCTTTCCATTTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies