Top » Catalog » J1 » A14649

$18.00

A14649
[A14649]

A14649
hg38 Position: ChrY:16124248..16124248
Ancestral: A
Derived: T
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A14649_F ACTTACCTGGCAGGACTTGC
Reverse Primer: A14649_R GCGTGTGCATGTTTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC5943
1 x FGC12832
1 x A12499
1 x BY9874
1 x S9378
1 x Y12645
1 x BY188919
1 x MF669
$144.00
Haplogroup Info
Other products
Currencies