Top » Catalog » J1 » A14649

$18.00

A14649
[A14649]

A14649
hg38 Position: ChrY:16124248..16124248
Ancestral: A
Derived: T
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A14649_F ACTTACCTGGCAGGACTTGC
Reverse Primer: A14649_R GCGTGTGCATGTTTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK477
1 x FGC48147
1 x BY63983
1 x FGC34537
1 x A15549
1 x CTS4352
1 x FGC42836
1 x FGC37534
1 x ALK1
1 x FGC4742
1 x FGC4279
1 x ALK272
1 x FGC35893
1 x FGC37540
1 x FGC48151
1 x BY8
1 x A13646
1 x A11234
$324.00
Haplogroup Info
Other products
Currencies