Top » Catalog » J1 » A14650

$18.00

A14650
[A14650]

A14650
hg38 Position: ChrY:22361244..22361244
Ancestral: T
Derived: G
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A14650_F TTGCAATGAGGTTAAAAGAGAGC
Reverse Primer: A14650_R AGGTTCCAGGAATCCCAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies