Top » Catalog » J1 » A14650

$18.00

A14650
[A14650]

A14650
hg38 Position: ChrY:22361244..22361244
Ancestral: T
Derived: G
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A14650_F TTGCAATGAGGTTAAAAGAGAGC
Reverse Primer: A14650_R AGGTTCCAGGAATCCCAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY67806
1 x FGC48143
1 x FGC4430
1 x FGC4792
1 x A22924
1 x FGC42773
1 x ALK431
1 x FGC7379
1 x FGC4738
1 x ALK473
1 x FGC5229
1 x A13637
1 x ALK609
1 x FGC8216
1 x FGC1718
1 x A19276
1 x ALK12
1 x FGC10090
1 x FGC28711
$342.00
Haplogroup Info
Other products
Currencies