Top » Catalog » J1 » A14687

$18.00

A14687
[A14687]

A14687
hg38 Position: ChrY:13796143..13796143
Ancestral: G
Derived: C
Reference: Full Genomes (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A14687_F AAGAGCATGGTCCTCAGCAG
Reverse Primer: A14687_R AAGAGCAAGGGGGAAAGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies