Top » Catalog » J1 » A14885

$18.00

A14885
[A14885]

A14885
hg38 Position: ChrY:12156002..12156002
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A14885_F TGCTGTAACTCAACCACTGC
Reverse Primer: A14885_R TTTTTCCTCCCTTGTGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC42685
1 x FGC20888
1 x BY38100
1 x FGC42781
1 x A19217
1 x FGC16721
1 x FGC4452
1 x ALK253
1 x FGC48180
1 x FGC4243
1 x FGC31327
1 x ALK29
1 x FGC20883
1 x FGC5206
1 x FGC16723
1 x ALK869
$288.00
Haplogroup Info
Other products
Currencies