Top » Catalog » J1 » FGC5235

$18.00

FGC5235
[FGC5235]

FGC5235
hg38 Position: ChrY:16592409..16592409
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5235_F TGGAAACCACACTCATGGTC
Reverse Primer: FGC5235_R TTACCCAATGACCCAGGTTG
Reviews

Customers who bought this product also purchased
FGC59170
FGC59170
BY74
BY74
L174
L174
FGC12
FGC12
ZS1409
ZS1409
DYS454
DYS454
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A22144
1 x A22247
1 x FGC12863
1 x ALK488
1 x FGC7397
1 x BY4
1 x FGC40452
1 x FGC4783
1 x FGC8797
1 x FGC4782
1 x A14687
1 x FGC30610
1 x FGC21142
1 x FGC42459
1 x FGC10420
1 x FGC50952
$288.00
Haplogroup Info
Other products
Currencies