Top » Catalog » J1 » FGC59170

$18.00

FGC59170
[FGC59170]

FGC59170
hg38 Position: ChrY:6821818..6821818
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC59170_F TGTTCCATTTGAGGAACAATCC
Reverse Primer: FGC59170_R AACAAGCCTAAGTGCCATTAACC
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC59116
FGC59116
FGC62573
FGC62573
FGC41680
FGC41680
FGC5229
FGC5229
FGC5234
FGC5234
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies