Top » Catalog » J1 » FGC57173

$18.00

FGC57173
[FGC57173]

FGC57173
hg38 Position: ChrY:19242188..19242188
Ancestral: A
Derived: C
Reference: Full Genomes (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC57173_F TGGGCTGAAAACCACTTAGC
Reverse Primer: FGC57173_R GTGCTTTGCAACATACTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK27
1 x FGC8729
1 x A15552
1 x ALK533
1 x ALK240
1 x ALK399
$108.00
Haplogroup Info
Other products
Currencies