Top » Catalog » J1 » FGC10030

$18.00

FGC10030
[FGC10030]

FGC10030
hg38 Position: ChrY:14402339..14402339
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC4230
Forward Primer: FGC10030_F CAGACACACCTATCACCGTCTG
Reverse Primer: FGC10030_R ACATTTAGCAAGATTCCCTGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC40447
1 x FGC12857
1 x FGC37843
1 x BY32851
1 x ALK161
1 x ALK281
1 x FGC4417
1 x FGC4402
1 x A18931
1 x FGC4339
1 x A16982
1 x FGC40060
$216.00
Haplogroup Info
Other products
Currencies