Top » Catalog » J1 » FGC10030

$18.00

FGC10030
[FGC10030]

FGC10030
hg38 Position: ChrY:14402339..14402339
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC4230
Forward Primer: FGC10030_F CAGACACACCTATCACCGTCTG
Reverse Primer: FGC10030_R ACATTTAGCAAGATTCCCTGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4429
1 x FGC45005
1 x A19270
1 x FGC4313
1 x FGC3722
$90.00
Haplogroup Info
Other products
Currencies