Top » Catalog » J1 » FGC10031

$18.00

FGC10031
[FGC10031]

FGC10031
hg38 Position: ChrY:15328075..15328075
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC10033
Forward Primer: FGC10031_F TGTTGGTCTTCCCCATAAGC
Reverse Primer: FGC10031_R CTGCCACGTCTTTGACATTG
Reviews

Customers who bought this product also purchased
FGC10028
FGC10028
FGC10026
FGC10026
FGC10025
FGC10025
FGC10033
FGC10033
FGC10032
FGC10032
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC16640
$18.00
Haplogroup Info
Other products
Currencies