Top » Catalog » J1 » FGC16723

$18.00

FGC16723
[FGC16723]

FGC16723
hg38 Position: ChrY:18966688..18966688
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC4230
Forward Primer: FGC16723_F TTTGCTGTTTAATGTTGCAATTC
Reverse Primer: FGC16723_R AAGCCACTTTGAACATTTTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4451
$18.00
Haplogroup Info
Other products
Currencies