Top » Catalog » J1 » FGC29979

$18.00

FGC29979
[FGC29979]

FGC29979
hg38 Position: ChrY:15751749..15751749
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC29979_F CAACTCACTGCAACCTCTGC
Reverse Primer: FGC29979_R TTGGGACAACATGGAAAATG
Reviews

Customers who bought this product also purchased
FGC29978
FGC29978
FGC29977
FGC29977
FGC29980
FGC29980
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK899
1 x BY13778
1 x ALK18
1 x FGC4420
1 x FGC29979
1 x A20821
$108.00
Haplogroup Info
Other products
Currencies