Top » Catalog » J1 » FGC29980

$18.00

FGC29980
[FGC29980]

FGC29980
hg38 Position: ChrY:17047200..17047200
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC29980_F AAGTGTGTCTTAAACAAAAAAGTAACAGG
Reverse Primer: FGC29980_R GCATGACACACTTCCTGTTTCTC
Reviews

Customers who bought this product also purchased
FGC29979
FGC29979
FGC29978
FGC29978
FGC29977
FGC29977
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC7982
1 x FGC8216
$36.00
Haplogroup Info
Other products
Currencies