Top » Catalog » J1 » FGC23314

$18.00

FGC23314
[FGC23314]

FGC23314
hg38 Position: ChrY:7885967..7885967
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC23314_F TTTTGTGCCTCTTTATCTCATTTC
Reverse Primer: FGC23314_R GAGCTGTCTGCCTCATGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC23318
$18.00
Haplogroup Info
Other products
Currencies