Top » Catalog » J1 » FGC23315

$18.00

FGC23315
[FGC23315]

FGC23315
hg38 Position: ChrY:10233926..10233926
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC23315_F CACCGTAGTTCTCTAAGCATTCC
Reverse Primer: FGC23315_R GCCTTGAGGCCTATCATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A7458
$18.00
Haplogroup Info
Other products
Currencies