Top » Catalog » J1 » FGC23318

$18.00

FGC23318
[FGC23318]

FGC23318
hg38 Position: ChrY:13963244..13963244
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC23318_F AAGATAGTTCATCAACCGCATCAC
Reverse Primer: FGC23318_R TAGAAGCCCAAACATCAGCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies