Top » Catalog » J1 » FGC10028

$18.00

FGC10028
[FGC10028]

FGC10028
hg38 Position: ChrY:10110188..10110188
Ancestral: C
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC10033
Forward Primer: FGC10028_F CGTGATGTTAGGGTGCCG
Reverse Primer: FGC10028_R ACCTCACTACACCTATTCCAAAGTC
Reviews

Customers who bought this product also purchased
FGC10032
FGC10032
FGC10031
FGC10031
FGC10026
FGC10026
FGC10025
FGC10025
FGC10033
FGC10033
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies