Top » Catalog » J1 » FGC62573

$18.00

FGC62573
[FGC62573]

FGC62573
hg38 Position: ChrY:8904137..8904137
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC62573_F CGCTGGTCCCTCTCTCTGC
Reverse Primer: FGC62573_R ACATAGAAAACCCACCCCCTAC
Reviews

Customers who bought this product also purchased
L858
L858
FGC5230
FGC5230
Z642
Z642
Z640
Z640
FGC5
FGC5
FGC23369
FGC23369
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC67293
1 x CTS9501
$36.00
Haplogroup Info
Other products
Currencies