Top » Catalog » J1 » A15545

$18.00

A15545
[A15545]

A15545
hg38 Position: ChrY:15846563..15846563
Ancestral: G
Derived: C
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A15545_F CCCTACCCCCTTTTCAACTG
Reverse Primer: A15545_R GCAAAGGTTTCCTGGAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC37530
1 x FGC2
1 x FGC41723
1 x FGC4770
1 x A13641
1 x AMM394
1 x FGC42457
1 x BY111515
1 x A21958
1 x FGC5433
1 x FGC37491
$198.00
Haplogroup Info
Other products
Currencies