Top » Catalog » J1 » A15546

$18.00

A15546
[A15546]

A15546
hg38 Position: ChrY:19742272..19742272
Ancestral: T
Derived: C
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A15546_F GGACTTAAAGGTGGCTTGACC
Reverse Primer: A15546_R ATCCAGCAACAGAGTGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies