Top » Catalog » J1 » A15546

$18.00

A15546
[A15546]

A15546
hg38 Position: ChrY:19742272..19742272
Ancestral: T
Derived: C
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A15546_F GGACTTAAAGGTGGCTTGACC
Reverse Primer: A15546_R ATCCAGCAACAGAGTGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19930
1 x A20818
1 x FGC22751
1 x ALK443
1 x FGC5464
1 x ALK610
1 x FGC4415
1 x FGC4741
1 x A15548
1 x A14649
1 x FGC5462
1 x FGC6526
1 x FGC31627
1 x FGC10414
1 x FGC48145
1 x ALK138
1 x FGC37851
1 x FGC42175
1 x FGC3712
1 x A19220
1 x ALK28
$378.00
Haplogroup Info
Other products
Currencies