Top » Catalog » J1 » A15548

$18.00

A15548
[A15548]

A15548
hg38 Position: ChrY:8706344..8706344
Ancestral: G
Derived: C
Reference: Ahmad Alroqi (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A15548_F TGCACATTCATGAGGTAGGC
Reverse Primer: A15548_R GGCCATCTTTTGTTGACACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies